| |
Telaprevir and pegylated interferon-alpha-2a inhibit wild-type and resistant genotype 1 hepatitis C virus replication in patients
|
| |
| |
Link to efficacy and safety data reported at EASL April 2007:
3-Drug HCV therapy for 12 weeks: VX950+pegIFN+RBV, interim results from phase II PROVE 1 Trial - (04/17/07)
Hepatology Aug 6, 2007
Tara L. Kieffer 1, Christoph Sarrazin 2, Janice S. Miller 1, Martin W. Welker 2, Nicole Forestier 2, Ann D. Kwong 1 *, Stefan Zeuzem 2
1Vertex Pharmaceuticals Inc., Cambridge, MA
2Klinik fur Innere Medizin II, Universitat des Saarlandes, Homburg/Saar, Germany
Funded by:
Vertex Pharmaceuticals Inc., Cambridge, MA
Deutsche Forschungsgemeinschaft; Grant Number: KFO 129; Teilprojekt 2
"....In conclusion, telaprevir dosing produced a rapid and dramatic reduction in viral load in all patients when given alone and in combination with PEG-IFN-alpha-2a. In a subset of patients given telaprevir alone, clinical breakthrough associated with resistant variants was observed. The kinetics of selection of different resistant variants suggest that these variants are present before dosing at different levels, depending on their fitness compared with wild-type.....For example, the A156T variant was detected in 3 of 8 patients at a frequency of 0.36%-0.75%. However, in this study, variants were inhibited in all patients after they began PEG-IFN-alpha-2a and RBV follow-on treatment. Most importantly, when patients were initiated on the combination of telaprevir and PEG-IFN-alpha-2a, no clinical breakthrough was observed in any patient, even though resistant variants were detected in some samples by our sensitive methods. These results suggest that the combination of telaprevir + PEG-IFN-alpha-2a, with or without RBV, can inhibit growth of both wild-type and resistant variants..."
Abstract
Telaprevir (VX-950) is an orally active, specifically targeted antiviral therapy for hepatitis C virus (HCV) that has been shown to profoundly reduce plasma HCV RNA in genotype 1 patients. Using a highly sensitive sequencing assay that detects minor populations of viral variants (>/=5%), mutations were identified that conferred low-level (V36M/A, T54A, or R155K/T) or high-level (A156V/T and 36/155) resistance to telaprevir in vitro.
We report a detailed kinetic analysis of these variants in 16 patients given telaprevir or telaprevir + pegylated interferon-alpha-2a (PEG-IFN-alpha-2a) for 14 days. In 4 patients who had a viral rebound on telaprevir alone, the R155K/T and A156V/T variants were detected during the initial steep decline in HCV RNA. During the rebound phase, the R155K/T and A156V/T variants were replaced by V36(M/A)/R155(K/T) double mutant variants. In the remaining 12 patients given telaprevir alone or with telaprevir/PEG-IFN-alpha-2a, the A156V/T variant was detected in some patients, but viral levels continued to decline in all patients.
Conclusion: These studies suggest that the initial antiviral response to telaprevir is due to a sharp reduction in wild-type virus, which uncovers pre-existing telaprevir-resistant variants. In patients given telaprevir alone, viral rebound can result from the selection of variants with greater fitness. However, the combination of telaprevir and PEG-IFN-alpha-2a inhibited both wild-type and resistant variants. In the present study, every patient who began PEG-IFN-alpha-2a and ribavirin after the 14-day dosing period had undetectable HCV RNA levels at 24 weeks, indicating that telaprevir-resistant variants are sensitive to PEG-IFN-alpha-2a and ribavirin.
Discussion
To understand the kinetics of the emergence of viral variants with decreased sensitivity to telaprevir, sequential clonal sequence analysis of the HCV NS3 protease catalytic domain was performed in patients with HCV genotype 1. Patients were given either placebo + PEG-IFN-alpha-2a (n = 4), telaprevir alone (n = 8), or telaprevir + PEG-IFN-alpha-2a (n = 8) for 14 days. Samples for viral sequencing were collected at baseline (pre-dose on day 1) and days 4, 8, 12, and 15 of dosing. All patients were offered PEG-IFN-alpha-2a and RBV and samples were collected at 1, 12, and 24 weeks after the end of the 14-day dosing period. The resistant mutations at 4 locations in the HCV protease catalytic domain identified in the first 14-day telaprevir clinical trial were also observed in the present study (low-level resistance, single mutations at positions V36A/M, T54A, and R155K/T; high-level resistance, single mutation at position A156V/T and double mutations at positions 36/155 and 36/156). No consistent secondary mutations were detected; however, this study is limited to observations in the HCV NS3 protease catalytic domain, and further analysis of the NS4A region and protease cleavage sites and longer exposure to telaprevir may reveal compensatory mutations.
All patients who received telaprevir alone had an initial rapid and profound antiviral response to telaprevir, reflected by a sharp decline in wild-type virus. This initial decline in HCV RNA was followed by viral persistence in half of the patients given telaprevir alone (n = 4). In these 4 patients, as wild-type virus was cleared, single mutation variants were uncovered and became dominant by day 8. Although a mixture of variants was observed at day 4, the R155K/T or A156V/T variants became predominant at day 8, likely because they confer higher levels of resistance than the V36A/M or T54A variants. An increase in HCV RNA levels occurred by day 12 to 15, which was associated with the selection of higher-level resistant variants containing a double mutation at positions 36/155. The 36/155 double mutant confers high-level resistance to telaprevir, and its predominance by the end of dosing indicates that this variant likely has an improved fitness compared with other high-level resistant variants (A156V/T or 36/156). The dynamic changes in HCV variants in patients with a rebound response to telaprevir monotherapy suggest that when resistance is present initially as a single mutation, upon continued replication, other resistant mutations may accumulate. However, treatment with PEG-IFN-alpha-2a and RBV inhibited growth of all the variants and all patients had a continued antiviral response pattern through week 24, suggesting these variants are sensitive to IFN and RBV.
The other 4 patients who received telaprevir alone all experienced a continuous decline in plasma HCV RNA titer throughout the dosing period. The high-level resistant A156V/T variant was detected in 2 of these patients, but HCV RNA levels continued to decline with telaprevir alone and were undetectable in all 4 patients at 12 and 24 weeks, suggesting that PEG-IFN-alpha-2a and RBV follow-on therapy and/or the immune system continued to inhibit growth of the remaining virus.
All 8 patients given telaprevir alone had an initial rapid and profound antiviral response. Subsequently, the 4 patients with genotype 1a infection experienced a viral rebound, while the other 4 patients with genotype 1b infection had a continuous decline in viral load. The V36M and R155K/T variants are observed only in patients with genotype 1a due to a lower genetic barrier; these mutations require only 1 nucleotide change in the triplet codon compared with 2 changes required in genotype 1b. Unlike the A156V/T variants predominantly selected in genotype 1b patients, the V36M and R155K/T variants are more fit, and their selection underlies the rebound response observed in genotype 1a patients. Thus, the continued decline observed in genotype 1b patients may be due to the slower growth rate (impaired fitness) of the A156V/T variant, and perhaps the immune system is more likely to inhibit growth of the virus. However, in all 7 patients who began follow-on treatment with PEG-IFN-alpha-2a and RBV, HCV RNA levels were reduced below the limit of detection.
All patients receiving telaprevir + PEG-IFN-alpha-2a had a rapid initial HCV RNA decline followed by continued slower decline. Resistant variants were detected in only 2 patients, each at a single sampling time. One patient had the A156T variant at day 8, but HCV RNA levels were undetectable (<10 IU/mL) at the next sampling time (day 12), indicating that the combination of telaprevir + PEG-IFN-alpha-2a was able to inhibit growth of this variant. The second patient had the V36A variant 1 week after the end of telaprevir dosing, but HCV RNA levels were undetectable (<10 IU/mL) 12 and 24 weeks after dosing while on PEG-IFN-alpha-2a and RBV therapy. This suggests that treatment with PEG-IFN-alpha-2a and RBV and/or the immune system was able to inhibit growth of the V36A variant. All 8 patients in this group achieved undetectable levels of HCV by week 12 and through week 24 on PEG-IFN-alpha-2a and RBV.
In conclusion, telaprevir dosing produced a rapid and dramatic reduction in viral load in all patients when given alone and in combination with PEG-IFN-alpha-2a. In a subset of patients given telaprevir alone, clinical breakthrough associated with resistant variants was observed. The kinetics of selection of different resistant variants suggest that these variants are present before dosing at different levels, depending on their fitness compared with wild-type. A recent analysis by McPhee et al.[30] determined the baseline prevalence of HCV protease inhibitor-resistant variants using a highly sensitive single-nucleotide polymorphism assay (limit of detection <0.1%). For example, the A156T variant was detected in 3 of 8 patients at a frequency of 0.36%-0.75%. However, in this study, variants were inhibited in all patients after they began PEG-IFN-alpha-2a and RBV follow-on treatment. Most importantly, when patients were initiated on the combination of telaprevir and PEG-IFN-alpha-2a, no clinical breakthrough was observed in any patient, even though resistant variants were detected in some samples by our sensitive methods. In every patient who received telaprevir, including those in whom resistant variants were detected, HCV RNA remained undetectable through 24 weeks with PEG-IFN-alpha-2a and RBV follow-on therapy. These results suggest that the combination of telaprevir + PEG-IFN-alpha-2a, with or without RBV, can inhibit growth of both wild-type and resistant variants. The results of this study provide further support for the clinical development of telaprevir coadministered with PEG-IFN-alpha-2a as a promising new strategy to treat HCV infection.
Article Text
Over 170 million people are infected with hepatitis C virus (HCV) worldwide.[1] The current standard treatment with pegylated interferon (PEG-IFN) and ribavirin (RBV) has limited efficacy and causes significant side effects.[2][3] Novel, specifically targeted antiviral therapies for HCV include HCV protease inhibitors, which block the NS3¥4A protease-dependent cleavage of the HCV polyprotein, an essential step in viral replication (reviewed by Foster,[4] Gish,[5] Pawlotsky and McHutchison,[6] and McHutchison et al.[7]). Telaprevir (VX-950) is a potent and specific NS3¥4A protease inhibitor that has demonstrated substantial antiviral activity in patients infected with HCV genotype 1.[8] The rapid replication rate of HCV, along with the low fidelity of its polymerase, gives rise to an accumulation of mutations throughout the viral genome generating remarkable sequence variation in the HCV population, which exists as a quasispecies. The presence of numerous viral variants generates a source for the selection of drug-resistant virus in patients treated with specifically targeted antiviral therapies.
Drug-resistant mutations have been shown to develop in vitro in the presence of numerous specifically targeted antiviral therapies for HCV. Mutations have been identified in the NS5B gene that confer resistance to the polymerase inhibitors NM283 (S282T),[9][10] JTK-109 (P495L/A),[11] HCV-796 (C316F/Y and S365T/A),[12] A-782759 (H95Q, N411S, M414L/T, or Y448H),[13] MK-0608 (S282T),[14][15] and R1479 (S96T and S96T/N142T).[16] Mutations have been identified in the NS3 gene that confer resistance to the protease inhibitors BILN 2061 (R155Q, A156V/T, and D168V/A),[13][17][18] telaprevir (A156V/T/S),[18][19] SCH6 (A156V/T and R109K),[20] SCH 503034 (T54A, A156S/T, and V170A),[21] and ITMN-191 (D168A/V/E, A156S/V, F43S, Q41R, V23A, S138T, and S489L).[22] Recent in vivo studies have confirmed the development of a resistant mutation against SCH 503034 at position T54A[23] and against HCV-796 at C316Y.[24]
The initial selection of viral variants with decreased sensitivity to telaprevir alone in patients with HCV genotype 1 after 14 days - as well as at follow-up intervals of 7-10 days and 3-7 months after dosing - has been described previously.[8][25] For that study, a highly sensitive sequence analysis method was used to characterize the resistant variants, which permitted the detection of variants in the catalytic domain of HCV NS3 protease at a sensitivity of approximately 5%, and determined the linkage between mutations. The genotypic identification of viral variants was coupled with both enzymatic and replicon phenotypic resistance assays to determine the shift in inhibition of the variants by telaprevir compared with wild-type. Mutations at position V36A/M, T54A, and R155K/T in the HCV NS3¥4A protease catalytic domain conferred low levels of resistance to telaprevir, while A156V/T mutations conferred high levels of resistance to telaprevir. All telaprevir-resistant variants remained fully sensitive to IFN in the HCV replicon system.[26] In addition, the in vivo fitness of viral variants was estimated using a novel method that assessed their in vivo growth rate in the absence of telaprevir selective pressure. Comparison of the viral population at the end of dosing and follow-up time points showed the return of wild-type virus and a rapid decline in highly resistant variants, indicating differences in viral fitness in the absence of telaprevir-selective pressure.
Because the telaprevir-resistant HCV variants had reduced fitness and the concentration of HCV in the plasma was substantially reduced in most patients after 14 days of dosing with telaprevir alone, it is possible that the host immune system can clear the virus by inhibiting the growth of the remaining less fit telaprevir-resistant virions. The addition of IFN to the treatment regimen to increase the antiviral effect and boost the host immune system may be necessary for a sustained viral response to occur. In vitro data from the HCV replicon system suggest that telaprevir and IFN act synergistically to reduce HCV RNA levels[27] and that variants with decreased sensitivity to telaprevir remain sensitive to IFN and RBV.[26] The additional antiviral effect of IFN may also cause a more rapid initial HCV RNA decline, thereby decreasing the chance that variants with decreased sensitivity to telaprevir are able to emerge.
In a phase 1 clinical trial (VX04-950-103), 16 patients were given telaprevir alone (n = 8) or in combination with PEG-IFN-alpha-2a (n = 8) for 14 days.[28][29] The majority of adverse events were mild and there were no serious adverse events or premature discontinuations. This study confirmed the substantial antiviral effects of telaprevir and showed an increased antiviral effect of telaprevir combined with PEG-IFN-alpha-2a.
This study describes the kinetics of selection of HCV-resistant variants during dosing in patients treated with telaprevir alone or in combination with PEG-IFN-alpha-2a for 14 days.[28] Sequence analysis of the NS3 protease domain was performed at days 4, 8, 12, and 15 (end of dosing). After the end of dosing with telaprevir alone or with PEG-IFN-alpha-2a, sequencing analyses were performed to determine whether telaprevir-resistant variants could persist in the presence of 1, 12, and 24 weeks of additional treatment with PEG-IFN-alpha-2a + RBV.
Patients and Methods
Study Design.
Twenty treatment-naive patients with genotype 1 HCV (6 subtype 1a; 14 subtype 1b) were enrolled in a phase 1b, randomized, multiple-dose clinical trial and treated with either placebo + PEG-IFN-alpha-2a (Hoffmann-LaRoche, Germany), telaprevir alone, or telaprevir + PEG-IFN-alpha-2a.[28] The study was conducted in full compliance with the Guidelines of Good Clinical Practice and the World Medical Assembly Declaration of Helsinki and was approved by the institutional review board at each site. All patients provided written informed consent to participate. Patients were between 18 and 60 years of age, had baseline plasma HCV RNA levels of at least 1 X 105 IU/mL, and were hepatitis B- and HIV-negative. Patients were enrolled and randomized into 1 of 3 treatment regimens: placebo every 8 hours orally and PEG-IFN-alpha-2a once weekly (4 patients); telaprevir every 8 hours orally (8 patients); or telaprevir every 8 hours orally and PEG-IFN-alpha-2a once weekly (8 patients) for 14 consecutive days. The first dose of telaprevir was a loading dose of 1,250 mg; subsequent doses were 750 mg every 8 hours. PEG-IFN-alpha-2a was given via subcutaneous injection at a dose of 180 g. After the study was completed, all patients were offered standard therapy for HCV genotype 1 (PEG-IFN-alpha-2a 180 g/week + RBV 1,000 or 1,200 mg/day, depending on weight). Some patients waited to start PEG-IFN-alpha-2a + RBV for up to 5 days after the end of the 14-day study period because they wanted to adjust their IFN dosing schedule.
Analysis of HCV RNA Levels.
Plasma HCV RNA levels were measured using the Roche COBAS Taqman HCV/HPS assay (Roche Molecular Systems Inc., Branchburg, NJ). The lower limit of quantitation was 30 IU/mL and the limit of detection was 10 IU/mL for the assay. HCV RNA levels were measured on days 1 through 4 and on days 8, 11, 13, and 15 of the study period and 3 days, 1, 12, and 24 weeks after the end of the study.
Amplification and Sequencing of the HCV NS3 Protease From Patient Plasma.
Sequencing of HCV was done by seminested reverse-transcriptase PCR amplification of the full 534-bp NS3 protease catalytic domain from plasma virus described in detail elsewhere.[25] Briefly, HCV virions were lysed under denaturing conditions from 140 to 560 L of plasma and HCV RNA was isolated. A complementary DNA fragment of the NS3 region was synthesized from viral RNA and amplified using primers flanking the NS3 protease catalytic domain (NS3_5, GGCGTGTGGGGACATCATC; NS3_3-1, GGTGGAGTACGTGATGGGGC). The first PCR product was diluted 1:10 and used in a seminested reaction (NS3_5 and NS3_3-2, CATATACGCTCCAAAGCCCA).
Due to low HCV RNA levels and/or sequence diversity in primer binding regions, some samples did not amplify using the standard protocol above (limit of detection 1,000 IU/mL). In these cases, a patient-specific assay was developed to increase the sensitivity to 100 IU/mL. Nested PCR primers were designed within the first 30 and last 30 nucleotides of the HCV NS3 protease region based on patient baseline sequence.
The DNA from this PCR was gel-purified, and the isolated DNA was cloned. Cloning plates were sent to Agencourt Biosciences (Beverly, MA) where 96 clones were amplified and sequenced per patient per time point. Population sequencing was performed on baseline samples.
Sequence Alignment and Analysis.
Sequences were aligned and analyzed for mutations using the software Mutational Surveyor (SoftGenetics, State College, PA). The first 543 nucleotides (181 amino acids) of the NS3 protease were analyzed. Clonal sequences were compared with the population baseline sequence for each patient. Any change from baseline representing >10% of the clonal population was considered a potential mutation. All identified changes were then compared with our own patient baseline sequence alignments or a public HCV sequence database (www.hcv.lanl.gov/content/hcv-db/index) to determine whether the changes had been identified previously. Mutations are labeled with the wild-type amino acid first, followed by the position in the NS3 gene (with numbers starting from the beginning of the gene), and then the mutated amino acid (that is, V36M indicates a change at position 36 within the NS3 gene from the wild-type amino acid, valine, to a methionine).
Accession Numbers.
The Genbank accession numbers for the baseline consensus sequences of the NS3 protease of the 20 patients of the present study are AM712636 - AM712655.
Results
Antiviral Response Analysis
The antiviral responses for each of the 3 dose groups are shown in Fig. 1. The median change in HCV RNA from baseline to day 15 was -1.09-log10 (range, -2.08 to -0.46) in the placebo + PEG-IFN-alpha-2a group (n = 4), -3.99-log10 (range, -5.28 to -1.26) in the telaprevir group (n = 8), and -5.49-log10(range, -6.54 to -4.30) in the telaprevir + PEG-IFN-alpha-2a group (n = 8). Day 15 HCV RNA levels were undetectable (<10 IU/mL) in 4 patients who received telaprevir + PEG-IFN-alpha-2a and in 1 patient who received telaprevir alone.
Figure 1. Median change from baseline of plasma HCV RNA: PEG-IFN-alpha-2a alone, telaprevir alone, and telaprevir + PEG-IFN-alpha-2a groups. The median change in plasma HCV RNA from baseline over the 14-day telaprevir dosing period for patients given PEG-IFN-alpha-2a alone (red circles [n = 4]), telaprevir alone (green squares [n = 8]), or telaprevir + PEG-IFN-alpha-2a (blue triangles [n = 8]) is shown.[28] Arrows indicate samples taken for sequence analysis at baseline (day 1) and at days 4, 8, 12, and 15 of dosing. Additional samples not shown were also collected at 1, 12, and 24 and weeks.
Patients in the telaprevir and telaprevir + PEG-IFN-alpha-2a groups were categorized as having a rebound or continued decline in HCV RNA. Patients who had an increase from the lowest HCV RNA level measured during the dosing period and for whom the day 15 HCV RNA level was >50 IU/mL were categorized as having HCV RNA rebound. Continuous decline was defined as no increase in HCV RNA from nadir to the end of dosing (day 15) or a day 15 HCV RNA level less than 50 IU/mL. Four of the 8 patients in the telaprevir group had rebound and the other 4 had a continuous decline in HCV RNA. All 8 patients in the telaprevir + PEG-IFN-alpha-2a group had a continuous antiviral response, and no breakthrough was observed.
Nineteen of the 20 patients began standard therapy after completing the dosing period; 7 of 8 in the telaprevir group and all 8 in the telaprevir + PEG-IFN-alpha-2a group. Twelve weeks after starting standard therapy, HCV RNA was undetectable in 5 patients in the telaprevir group and in all 8 patients in the telaprevir + PEG-IFN-alpha-2a group. At 24 weeks, HCV RNA was undetectable in all patients who started standard therapy in both the telaprevir alone (n = 7) and telaprevir + PEG-IFN-alpha-2a groups (n = 8).
Sequence Analysis
For sequence analyses, samples were collected from patients at 8 time points (Fig. 1): day 1 before dosing (baseline sample); day 4, 8, 12, and 15 (end of dosing); and during follow-up visits at weeks 1, 12, and 24 after the last dose of study drug.
Baseline samples from all 20 patients were sequenced by population-based sequencing. Clonal sequence data are available for all other samples with an HCV RNA >100 IU/mL, and an average of 76 sequences per patient per time point were obtained. Potential resistant mutations were identified by comparing the sequences obtained during dosing with the baseline population sequence for each patient. Mutations identified at a frequency of >10% and observed in more than 1 patient were considered potential resistance mutations. The percent of mutations at each of 181 positions was calculated, and any nonpolymorphic change >10% from baseline was identified. No telaprevir-resistance mutations were observed in the 4 patients who received PEG-IFN-alpha-2a alone.
Following this approach, telaprevir-resistant mutations were detected at 4 amino acid positions in the HCV NS3 protease catalytic domain: 36, 54, 155, and 156. The most frequently observed mutations were V36A/M, T54A, R155K/T, and A156V/T, and these changes occurred as either single mutations (V36A/M, T54A, R155K/T, A156S/T/V) or as double mutations (at positions 36/155 or 36/156). These mutations were also identified in a previous 14-day clinical study of telaprevir alone in patients infected with HCV genotype 1.[25] Replicon and enzymatic phenotypic studies determined that variants V36A/M, T54A, and R155K/T conferred low levels of resistance to telaprevir (<25-fold increase in replicon IC50 from wild-type), while A156V/T, V36(M/A)/R155(K/T), and V36(M/A)/A156(V/T) mutations conferred higher levels of resistance to telaprevir (>50-fold increase in replicon IC50 from wild-type) (Fig. 2).
Figure 2. Comparison of relative fitness and in vitro phenotypic resistance of telaprevir resistant viral variants. Wild-type and resistant variants are listed in the bottom arrow along with their fold change in in vitro enzymatic and replicon median inhibitory concentration (IC50) from baseline.[25] Wild-type virus is shown in purple, and resistant variants are ordered from least resistant in green on the left to most resistant in red on the right. Relative fitness was estimated in a previous study by measuring the growth of each variant in patients after the end of dosing in the absence of telaprevir-selective pressure.[25] Growth rates were calculated on the basis of the absolute number of plasma HCV RNA (IU/mL) of each HCV variant as determined by their relative frequency at each time point. The white bar represents the median relative fitness; colored boxes indicate the first and third quartiles. The brackets outside the box represent the minimum and maximum (range) of fitness values.
Patients Receiving Telaprevir Alone
Patients who received telaprevir alone were divided into 2 subgroups based on HCV RNA response during the study period: decline followed by rebound (n = 4) and continued decline (n = 4).
Patients With Rebound in HCV RNA Levels.
Four of the 8 patients receiving telaprevir alone had a rebound response that was detected in 3 patients (genotype 1a) at day 8 (HCV RNA nadir was 50 IU/mL for patient 3017, 1,000 IU/mL for patient 3006, and 2,000 IU/mL for patient 1002) and 1 patient (1018; genotype 1a) at day 12 (nadir was 2,000 IU/mL). After the 14-day telaprevir dosing period, 3 of these patients started standard therapy with PEG-IFN-alpha-2a and RBV. At the week 12 follow-up visit, HCV RNA levels had decreased significantly to undetectable <10 IU/mL (1018), unquantifiable <30 IU/mL (3006), or 86 IU/mL (3017).
Virus isolated from these patients at day 4 was mostly wild-type but also contained low levels (5%-20%) of V36A/M, R155K/T, and A156V/T single mutants, which increased in the population of virus isolated at days 8 and 12. By day 15 and continuing into the week 1 follow-up time point, the single mutation variants were replaced by high-level resistant double mutant (36/155) variants. Previous studies have determined the in vivo fitness of telaprevir-resistant variants (Fig. 2) by calculating the rebound (growth) rate of each variant in patients after the end of dosing in the absence of drug-selective pressure.[25] The double mutant 36/155 variant had both higher levels of resistance as well as slightly higher relative fitness compared with the R155K/T single mutation variant (Fig. 2). Figure 3 shows the viral variants and HCV RNA levels for all patients with rebound.
Figure 3. Plasma HCV RNA levels and frequency of viral variants for patients receiving telaprevir alone with a rebound in HCV RNA. Plasma HCV RNA levels are plotted as a function of days after initial dosing, where the end of the 14-day telaprevir dosing period is indicated by the dark vertical line, and followed by up to 12 weeks of PEG-IFN-alpha-2a and RBV treatment. The horizontal dotted line represents the limit of detection for the sequencing assay of 100 IU/mL, and the lower limit of HCV RNA detection (10 IU/mL) is indicated by the darker gray area. The total plasma viral titer is depicted by the blue line. Filled white boxes represent samples with viral titer below the limit of detection of the sequencing assay where no sequence data are available. For samples with higher viral titer where sequencing was successful, the bars beneath each time point represent the percent of each variant observed at that time point. Wild-type virus is shown in purple, and resistant variants are ordered from least resistant in green to most resistant in red.
Patients with Continued Decline in HCV RNA Levels.
Four of the 8 patients receiving telaprevir alone had a continuous decline in HCV RNA throughout the 14-day dosing period. Of these 4 patients (genotype 1b), sequence data were available (HCV RNA >100 IU/mL) for all patients at day 4 and for 2 patients (1004 and 3012) at days 8, 12, and 15 (Fig. 4). At day 4, only wild-type virus was detected. Sequence analysis at later time points in patients 1004 and 3012 revealed predominantly high-level resistant A156V/T variants and a small amount of the low-resistance V36A/M and T54A variants. All 4 patients had undetectable HCV RNA at 12 and 24 weeks after they began PEG-IFN-alpha-2a and RBV follow-on therapy.
Figure 4. Plasma HCV RNA levels and frequency of viral variants for patients receiving telaprevir alone with a continuous decline in HCV RNA. Plasma HCV RNA levels plotted as a function of days after initial dosing where the end of the 14-day telaprevir dosing period is indicated by the dark vertical line, and followed by up to 12 weeks of PEG-IFN-alpha-2a and RBV treatment. The horizontal dotted line represents the limit of detection for the sequencing assay of 100 IU/mL, and the lower limit of HCV RNA detection (10 IU/mL) is indicated by the darker gray area. The total plasma viral titer is depicted by the blue line. Filled white boxes represent samples below the limit of detection of the sequencing assay where no sequence data are available. For samples with higher viral titers where sequencing was successful, the bars beneath each time point represent the percent of each variant observed at that time point. Wild-type virus is shown in purple, and resistant variants are ordered from least resistant in green to most resistant in red.
Patients Receiving Telaprevir + PEG-IFN-alpha-2a
All 8 patients (1 genotype 1a, 7 genotype 1b) who received the combination of telaprevir and PEG-IFN-alpha-2a had a continued antiviral response during the dosing period. After 14 days, 4 patients had undetectable HCV RNA levels (<10 IU/mL) and only wild-type virus was detected in samples where sequence data is available from these patients (patients 1001, 3009, 3016, and 3013) (Fig. 5). Two patients had declining HCV RNA levels throughout the dosing period and had an HCV RNA level below the limit of quantification (<30 IU/mL, patient 3007) and 744 IU/mL on day 15 (patient 3011). Only wild-type virus was detected in these patients (Fig. 5).
Figure 5. Plasma HCV RNA levels and frequency of viral variants for patients receiving the combination of telaprevir + PEG-IFN-alpha-2a. Plasma HCV RNA levels are plotted as a function of days after initial dosing where the end of the 14-day telaprevir dosing period is indicated by the dark vertical line and followed by up to 12 weeks of PEG-IFN-alpha-2a and RBV treatment. The horizontal dotted line represents the limit of detection for the sequencing assay of 100 IU/mL, and the lower limit of HCV RNA detection (10 IU/mL) is indicated by the darker gray area. The total plasma viral titer is depicted by the blue line. Filled white boxes represent samples below the limit of detection of the sequencing assay where no sequence data are available. For samples with higher viral titer where sequencing was successful, the bars beneath each time point represent the percent of each variant observed at that time point. Wild-type virus is shown in purple, and resistant variants are ordered from least resistant in green to most resistant in red.
One patient (1005; genotype 1a) had undetectable HCV RNA levels (<10 IU/mL) at day 13 and levels below the lower limit of quantitation (<30 IU/mL) at day 15. Wild-type virus was present at day 4 and the high-level resistant A156T variant was detected at day 8. The HCV RNA level at day 8 was 123 IU/mL. At the next time point (day 12), HCV RNA levels were <30 IU/mL, indicating that the combination of telaprevir + PEG-IFN-alpha-2a was able to inhibit growth of this variant.
In one patient (3019; genotype 1b), wild-type virus was detected at days 4 and 8 and HCV RNA levels were below the lower limit of quantitation (<30 IU/mL) at day 13 and 35 IU/mL at day 15. This patient had a 2-day delay in starting PEG-IFN-alpha-2a and RBV follow-on treatment after the end of study drug dosing and had an HCV RNA level of 672 IU/mL at the week 1 follow-up visit. At this visit, the low-level resistant V36A variant was predominantly observed. Despite the presence of this variant, HCV RNA levels continued to decline during PEG-IFN-alpha-2a and RBV follow-on therapy and reached undetectable levels (<10 IU/mL) by the week 12 follow-up visit.
All 8 patients in this treatment group had undetectable levels of HCV RNA (<10 IU/mL) at the week 12 and 24 follow-up visits while receiving PEG-IFN-alpha-2a and RBV follow-on treatment.
|
|
| |
| |
|
|
|
